cytogenetics
Cytogenetics = the study of metaphase chromosomes, their abnormalities, and the physiological/phenotypic consequences of those abnormalities.
Karyotype = Microscopic visualization of the metaphase chromosomes from an organism
Example: A human karyotype is made of 23 chromosome pairs arbitrarily arranged from largest (chromosome 1) to smallest (chromosome 22), and one pair of sex chromosomes (X and Y)*.
*If X were included in the size lineup it would fall between chromosome 7 and 8.
If Y were included it would be number 24, the smallest.
Chromosomes 1-22 are called autosomes
Chromosome X & Y are called sex chromosomes
Introduction
- It is important that cells only divide when appropriate. Usually cells are not dividing
- Cancers =cell anarchy. Individual cell keeps dividing, ignores communication
- Capacity for division is important: mechanism = MITOSIS Normally, cells divide to replace dead or missing cells
- intestinal cells divide every 3 days, are broken down by digestion
- blood cells last 3 months, are replaced by new cell division
- nerve cells usually don’t divide, last for life
- Embryo: almost constant cell division. Every 30 minutes.
- Sex cells are unique: in humans, males produce 500,000,000 /day. Females 1/month. Special type of cell division = MEIOSIS
CELL CYCLE
PROKARYOTIC ORGANISMS (unicellular)
- Cells eat, grow, divide by binary fission
- DNA organized into circular bacterial chromosome.
- Not complexed with histone proteins, does not condense into compact structure during division
- before division, single chromosome is replicated into two, separated to two sides of cell (by growth of membrane between attachment points?), pinch off, two new cells.
EUKARYOTIC ORGANISMS (unicellular or multicellular)
- Cells normally divide by mitosis
- Cells contain multiple chromosomes. In humans, 23 pairs of chromosomes = 46.
- Chromosomes made of chromatin; DNA (long, string-like molecule) complexed with histone proteins (~50% DNA, 50% histones)
- chromatin organized into nucleosomes, "beads on a string".
- chromatin has the ability to condense into tightly packed structure (= heterochromatin).
- chromosome = most compactly folded state of chromatin, only visible by light microscope when fully condensed (during mitosis or meiosis); at other times, dispersed in nucleus
- Diagram above shows a metaphase chromosome, made up of two sister chromatids. Chromatids will separate in anaphase, one going to each cell.
- Chromatids held together at centromere; location of centromere is always characteristic for any chromosome.
- kinetochore = proteinaceous region that forms at both sides of centromere, binds to microtubules (spindle fibers) to pull sister chromatids apart.
Stages of cell cycle: G1, S, G2, M
- Once a cell has complete dividing, it enters interphase, the stage between divisions
- Interphase is "normal" cell life — it is busy making proteins and other polymers, housecleaning, and doing whatever its special adaptations require of it.
- The stage following division (M), but preceding DNA synthesis (S) is called G1, or gap 1 phase. Actually, many cells sit in this phase for long periods of time, and some never leave it. Except for rapidly dividing cells, it makes more sense to think of this phase as Go, a point of exit from the cell cycle altogether.
- At some point, the cell may be "triggered" to begin preparing for another round of cell division. This critical step commits the cell to DNA synthesis, during which every chromosome is replicated. At this point the cell leaves G1 (or Go). This fairly long process is called "S" phase, for synthesis.
- Once S is completed, the cell continues to prepare for division, called the "G2", or gap 2 phase (gap between S and division).
- Once mitosis begins, the cell is in the "M" phase. Mitosis consumes most cell energy for its duration, so much normal cell activity ceases.
- The M phase terminates with cytokinesis, the physical separation of the two daughter cells.
Stages of MITOSIS & CYTOKINESIS
- Work through Mitosis: An interactive study guide from The Biology Place.
Interphase
- cell is not dividing
- cell is metabolically active
- nucleolus visible, ribosomes being made
- DNA duplicates (defines the S phase of interphase; before this is G1, after this is G2)
- nucleus intact
Prophase
- nucleolar material disperses
- centrosomes move to opposite ends of cells (in animal cells, centrioles involved)
- mitotic spindle forms — set of microtubules running from each pole to approximate middle of cell, overlap with polar microtubules from other end
- chromatin condenses, chromosomes appear as pairs of identical sister chromatids, held together at centromere
- kinetochores appear at centromere region (one for each chromatid)
- chromosomes attach to kinetochore microtubules
- nuclear membrane disappears
Metaphase
- microtubules from both poles manage to attach to kinetochores, pull chromosomes into a line at middle of cell = equatorial plate
- anatomy of metaphase chromosome: two identical chromatids, essentially two separate chromosomes, but still attached at centromere.
- Note: certain drugs (e.g. colchicine) block separation of chromosomes. All mitotic cells reach metaphase, stop = "metaphase arrest"
- Review diagram of metaphase
Anaphase
- chromosomes separate. Dynein protein involved (same protein used in ciliary contraction)
- very little energy needed; as little as 20 ATP’s per chromosome can pull it from equator to pole of cell
Telophase
- chromosomes arrive at poles
- chromosomes decondense, return to tangled mass of chromatin
- spindle disappears
- nuclear membrane reappears
- nucleolus reappears, ribosome synthesis begins anew
- Review diagram of telophase
Cytokinesis
- daughter cells are pinched apart
- In plants: new cell membrane appears as vesicles, wall grows
- In animals: cells are "pinched apart" by contraction of microfilaments
- Time line for stages of mitosis/cytokinesis
CONTROL OF MITOSIS
- Critical problem: how to tell cell to divide?
- If too often –> cancer
- If not often enough –> death
- Cell cycle control points and cancer
- Growth factors
- one of "hot" areas of research today; made by genetic engineering
- Special proteins produced in extremely tiny amounts stimulate growth
- Some of these genes have been cloned —> allows production of significant quantities, can use in research and clinical applications
- Real life example: Ammonia splashed in eye of refrigeration worker. Coating of eye failed to heal, only see blurs. Treat with drops of growth factor, cause new cell division, sight restored quickly.
- Several growth factors have been isolated, tissue specific. Nerve growth factor, fibroblast growth factor, etc.
- Growth suppressors
- also discovered a number of suppressors that block cell division.
- Dozens of different proteins affect division, either positively or negatively.
- How to understand?
- Cells contain mechanisms to die as well as grow and divide. Cell death = apoptosis.
- p53
- In human cancers, p53 is most common gene mutation observed.
- exact role of p53 in the cell cycle is unknown
- p53 induces apoptosis and exerts cell cycle inhibition in G1 phase.
- Mutations in p53 often –> altered proteins that bind and inactivate normal p53, leading to loss of regulation of cell cycle control.
- The antitumor effect of p53 gene transfer is also correlated with a reduction in blood vessel density in tumors suggesting mediation in anti-angiogenesis mechanisms.
- Numerous experiments have been performed to transfer the p53 gene to cells and tissues via lipid carriers and viral mediated methods. Some success in reducing
- Other genes involved in cancer
- Positive and negative regulators of growth and division
- recent theory: process of cell proliferation tightly linked with mechanism of cell death = `Two Signal: Death/Survival Model.’
- cell that departs from interphase will either divide or die with roughly equal probability.
- signals such as growth factors have the ability to influence this `decision’ and thus promote the growth of tissues.
- Prediction: at least two signals must cooperate in cell transformation into cancerous cell — one signal drives cells out of rest toward either cell proliferation or cell death, and one signal blocks cell death.
- recent discovery: c-myc, a gene known to be involved in cell proliferation, can participate in apoptosis (active cell death)
- another protein, bcl-2, known to cooperate with c-myc in cell transformation into cancer, blocked c-myc-induced apoptosis.
- Genes involved in cancer
SEXUAL REPRODUCTION
Gametes = sex cells produced in special organs
Male: sperm in testicles (anthers in plants) —> sperm or pollen
Female: eggs in ovaries
Meiosis
- unique type of cell division
- basically similar to mitosis, except:
- only produces gametes
- # of chromosomes reduced by half:Ex. Humans 46 -> 23
- requires two successive divisions without intervening DNA replication (no S phase)
- involves gene recombination —> each gamete is genetically unique
Stages of Meiosis
- involves 2 successive cell divisions Meiosis I & II -> 4 daughter cells, not 2
- superficially similar to mitosis: each division involves formation of spindle, progression through prophase, metaphase, anaphase, and telophase.
- But some differences, noted below:
prophase I
- homologous chromosomes pair up (synapsis)
- crossing over of segments -> new chromosome combinations diff. from parents. Morphologically, this looks like an X-shaped form, called chiasma (pl. chiasmata).
- 1st division pulls homologues apart (doesn’t separate at centromeres)
metaphase I
- separates the maternal and paternal chromosomes
- note: the centromeres do not split; so what gets pulled to each pole of the cell is a chromosome that looks like a mitotic metaphase chromosome (with paired sister chromatids)
telophase I
- Note: in some organisms, no real telophase; 2nd division follows immediately.
- No DNA synthesis (S phase) preceding meiosis II
metaphase II
- this division looks just like metaphase of mitosis, except there are only half as many chromosomes. In mitosis, there would be both a maternal and a paternal chromosome. In meiosis II, only one of these per cell.
Results of Meiosis
- Each gamete is different from others
- One reason for diversity: because maternal and paternal chromosomes sorted randomly; e.g. one human egg cell might have chromosome #1(M), 2(M), 3(P), 4(M), 5(P), 6(P), …. 23(M); a second egg might have #1(M), 2(P), 3(P), 4(P), 5(M), 6(M), …. 23(P). Note that each chromosome has 50% chance of being from father (P) or mother (M).
- What is chance that any two sex cells will be identical? 1 in 2 raised to the 23rd power = 1 in 8,388,608. So if someone tells you "you’re 1 a million", you should answer "No, I’m 1 in 8 million" (more or less)
- A second reason for this diversity = "Shuffling" of chromosomes. Each synaptic pair of homologous chromosomes undergoes recombination with random breakage and joining — so the actual chances of finding two gametes with identical chromosomes is not 1 in 8+ million, more like 1 in a trillion or less.
Meiotic errors
- Process of meiosis is incredibly complex; involves forming 23 homologous pairs, pulling them apart after chromosomes have been cut and pasted back together
- Mistakes can occur, and do occur.
- Nondisjunction: failure of one synaptic pair of chromosomes to separate during anaphase I. Results in one cell with 1 extra chromosome, 1 cell with one missing chromosome.
- Note: nondisjunction is relatively common. Estimated that 1 in 5 normal human pregnancies spontaneously abort in first two months, due to fertilized egg having too many or too few chromosomes.
- Common error is failure of a pair of chromosomes to separate during anaphase I, resulting in gamete with 24 or 22 chromosomes.
- When fertilized by normal gamete of opposite type, get 47 or 45 chromosome. For one of these chromosomes, will have 2N + 1N —> 3N in embryo (trisomy).
- Trisomy example: Down syndrome (extra copy of chromosome 21)
- View karyotype (chromosome spread)
- Visit Down Syndrome WWW page
- If gamete lacks a chromosome (0N) , is fertilized —> 1N in embryo (monosomy).
- Very rare for successful pregnancy to result after nondisjunction — only with smallest chromosomes or sex chromosomes. Even then, almost always leads to developmental abnormalities, some degree of mental retardation. E.g. Down syndrome, Turner’s syndrome, etc.
- Translocation: piece of one chromosome becomes attached to another chromosome. Probably results from error during crossing over. Can also produce Down syndrome, and many other errors.
DNA Structure and Replication |
|
|||
Note: These notes are provided as a guide to topics the instructor hopes to cover during lecture. Actual coverage will always differ somewhat from what is printed here. These notes are not a substitute for the actual lecture!
Types of Nucleic Acids
- Nucleic acids function primarily as informational molecules, for the storage and retrieval of information regarding the primary sequence of polypeptides.
- There are two types of nucleic acids:
- Deoxyribonucleic acid (DNA), which serves as a cellular database by storing an immense amount of information regarding all possible polypeptides a cell can make.
- Ribonucleic acid (RNA), which occurs in several different forms (messenger RNA, ribosomal RNA, transfer RNA) and is needed to convert DNA information into polypeptide sequences. In some viruses, RNA serves as the primary database with no DNA involvement. Certain RNAs have catalytic ability similar to that of protein enzymes; these are called ribozymes.
Nucleotide anatomy
- Nucleic acids are built from subunits called nucleotides.
- Each nucleotide includes three components:
- a ring-shaped molecule belonging to the class of purine or pyrimidine bases
- a 5-carbon, or pentose, sugar
- one or more phosphate groups
Purines & Pyrimidines
- Every nucleotide contains a nitrogenous base. These bases are classified as purines (two ring-shaped molecules joined together, one with 6 and one with 5 atoms) and pyrimidines (a single ring made from 6 atoms).
- In DNA, there are four different bases: Adenine (A) and Guanine (G) are the larger purines. Cytosine (C) and Thymine (T) are the smaller pyrimidines. These are frequently symbolized by their single letter abbreviations.
- RNA also contains four different bases. Three of these are the same as in DNA: Adenine, Guanine, and Cytosine. RNA contains Uracil (U) instead of Thymine (T).
How did Purines and Pyrimidines evolve? A possible origin for Adenine.
- At first glance, molecules such as adenine look very complex. How did they evolve to become part of nucleic acids? We can only speculate about such questions, but there are reasons for thinking that adenine is not all that complex a molecule.
- We know that the primitive Earth evolved around 4.5 billion years ago, and that initially there was no free oxygen. Compounds such as water (H2O), ammonia (NH3) and methane (CH4) were abundant, as was energy in the forms of heat, UV radiation, lightning, radioactivity, etc.
- Scientists have tried simulating such environments, boiling mixtures of gases and water with electric spark discharges. In some such experiments, purine and pyrimidine bases have been formed! A possible mechanism is shown in the accompanying diagram. This is not the way adenine is synthesized in cells today, but it suggests why such molecules may have been available in the primitive earth when life first evolved.
Ribose & Deoxyribose
- The sugars found in nucleic acids are pentose sugars, with five Carbon atoms.
- Ribose, found in Ribonucleic acid (RNA), is a "normal" sugar, with one oxygen atom attached to each carbon atom.
- Deoxyribose, found in Deoxyribonucleic acid (DNA), is a modified sugar, lacking one oxygen atom (hence the name "de-oxy"). This difference of one oxygen atom is an important one for the enzymes which recognize DNA and RNA, allowing these two molecules to be easily distinguished inside organisms.
Phosphate
- Phosphate groups can be joined together to form phosphodiester bonds.
- Nucleotides typically have one, two, or three phosphate groups, and are named monophosphate, diphosphate, or triphosphate accordingly.
- When phosphate groups are joined together, they have a strong tendency to repel each other, because of the high concentration of negative charge in the very polar and usually ionized oxygen atoms. As a result, molecules with two or three phosphate groups are good energy donors, readily releasing energy along with the transfer of phosphate groups. Nucleotides such as ATP and GTP are used not just for RNA or DNA synthesis, but also as energy donors for many cellular reactions.
ATP, ADP, AMP
- Let’s examine a set of nucleotides built with the purine base Adenine, the sugar deoxyribose, and one, two, and three phosphate groups.
- A combination of a base and a sugar is called a nucleoside.
- When the base Adenine is added to the sugar deoxyribose, the resulting nucleoside is deoxyadenosine. When one or more phosphates are added to this nucleoside, we have a nucleotide.
- We can name nucleotides by combining the nucleoside name (Deoxyadenosine) with the number of phosphates (mono-, di-, or tri-phosphate), as shown in the figure.
- Adenosine monophosphate, or AMP
- Adenosine diphosphate, or ADP
- Adenosine triphosphate, or ATP
The following tables give the names of bases and their corresponding nucleosides and nucleotides
Nucleotides involved in DNA
|
Base |
Deoxyribonucleoside |
Deoxyribonucleotides |
|
Adenine |
Adenosine |
dAMP, dADP, dATP |
|
Cytosine |
Cytidine |
dCMP, dCDP, dCTP |
|
Guanine |
Guanosine |
dGMP, dGDP, dGTP |
|
Thymine |
Thymidine |
dTMP, dTDP, dTTP |
Nucleotides involved in RNA
|
Base |
Ribonucleoside |
Ribonucleotides |
|
Adenine |
Adenosine |
AMP, ADP, ATP |
|
Cytosine |
Cytidine |
CMP, CDP, CTP |
|
Guanine |
Guanosine |
GMP, GDP, GTP |
|
Uracil |
Uridine |
UMP, UDP, UTP |
DNA and RNA
- Nucleotides can serve as monomers for the assembly of polymeric nucleic acids. When the nucleotides contain deoxyribonucleotides, the polymer is deoxyribonucleic acid, or DNA. DNA is normally double-stranded (although some viruses contain single-stranded DNA).
- Each strand of DNA consists of a "backbone" of alternating units of phosphate and deoxyribose. Purine or pyrimidine bases are attached to the 5-C deoxyribose sugar, and form base pairs with purine or pyrimidine bases from the opposite strand. The only effective pairs are Adenine with Thymine (A-T pairs) and Guanine with Cytosine (G-C pairs).
- When ribonucleotides serve as monomers, the resulting polymer is ribonucleic acid, or RNA. RNA is normally single-stranded (although some viruses contain double-stranded RNA). Many bases in RNA molecules such as ribosomal RNA and transfer RNA are chemically modified after polymerization, a process which makes these molecules more stable.
- An RNA consists of a "backbone" of alternating units of phosphate and deoxyribose. Purine or pyrimidine bases are attached to the 5-C ribose sugar.
Evidence for DNA as the genetic material
- Early in this century, little known about DNA; regarded as uninteresting junk
- Proteins were thought to be the only truly complex molecules in cells, and therefore must be responsible for heredity
- 1928: Frederick Griffith discovered phenomenon of transformation in bacteria
- Used organism Streptococcus pneumoniae.
- Strep bacillus has two forms:
- slimy colonies (S strain) forms mucous capsules, survives attack by macrophages in lung, kills mice
- rough colonies (R strain) lacks capsules, quickly killed by macrophage, no disease
- When Griffith mixed heat-killed S-strain with live R-strain, resulting organisms killed mice, and lungs were filled with S-strain.
- View diagram of Griffith experiment
- Conclusion: some chemical is surviving heat treatment, retains genetic information, is able to transmit that information to some R-strain bacteria, convert them to S. Griffith didn’t know what was responsible.
- 1944: Avery, McCarty and MacLeod demonstrate that DNA is responsible for transformation in bacteria
- Fractionated different chemicals in S-strain bacteria, tested each separately to see what would cause transformation.
- Isolated DNA could transform, but no other isolated fraction could (RNA, protein, lipids, polysaccharides). Conclusion: DNA is transforming principle
- But critics attacked slight (<1%) presence of protein in the DNA extracts used, claimed this might be responsible for transformation
- 1952: Hershey & Chase prove that only DNA is responsible for bacterial virus infection of host cells.
- Viruses (called phage if host cells are bacteria) are much simpler than cells, contain only DNA & protein.
- H&C were able to use different radioactive isotopes to distinguish DNA from protein: for DNA, used P-32 (lots of P in DNA, but none in protein); for protein, used S-35 (proteins contain S in certain amino acids, but DNA lacks S).
- H&C grew phage in hosts with either P or S radioisotope. Then infected different bacteria for short time, vortexed in blendor to separate phage coats from cells, and separated phage (very small) from cells (larger) by centrifugation.
- Result: only P-32 isotope found in cells. All S-35 could be knocked loose by blending, but cells were still infected and produced new phage. Therefore only DNA, not protein, was responsible for inheritance.
- View diagrams of H&C experiment (scroll down the page)
Structure of DNA
- DNA known to contain purine & pyrimidine bases, deoxyribose, and phosphate — but how are they arranged?
- 1947: Chargaff published data showing that % of A, T, C, and G showed certain regularities
- % of bases varies from organism to organism
- % A = % T, and % C = % G. This is called Chargaff’s rule. What did it mean?
- 1952: X-ray pictures of DNA taken by Rosalind Franklin in Wilkins lab in London showed some kind of helix.
- 1953: Watson & Crick published a model built from Franklin data = double helix. Suggested that Chargaff’s rule was due to base-pairing of A with T, C with G.
- Interact with DNA as Chime graphic
- In linear molecule, one strand has free 3′-end, where the other (complementary) strand has 5′-end.
- Two chains of DNA face in opposite directions, called antiparallel (defined by which way 3′ and 5′ sides of sugar molecule are facing). In linear molecule, one strand has free 3′-end, where the other (complementary) strand has 5′-end.
o 5'-CAGCTAGAGTCATCG-3'
o 3'-GTCGATCTCAGTAGC-5'
- W&C also suggested simple model for replication: if double stranded DNA uncoiled, each strand could serve as template for replication of new DNA. This was an exciting experimental prediction, and many labs set out to try to prove it.
Replication of DNA
- First enzyme isolated by Kornberg (—-> Nobel prize): DNA polymerase.
- Reaction: [dATP, dCTP, dGTP, dTTP] ——-(DNA polymerase, Mg++, template DNA)——–> new DNA + P~P (pyrophosphate)
- Note 1: P~P is immediately split into 2 Pi (inorganic phosphate ions).
- Note 2: energy for forming new sugar-phosphate bond comes from splitting a high-energy phosphate bond as P~P is removed. This always occurs at free 3′-OH group on deoxyribose (and on ribose in RNA synthesis). All nucleic acids grown by addition at 3′-end, not at 5′-end. Often referred to as 5′ —–> 3′ synthesis.
- Eventually discovered that cells have a variety of DNA polymerase enzymes; some serve for DNA repair rather than for new synthesis.
- Other enzymes and proteins involved:
- DNA helicase: unwinds DNA in front of opening replication fork (otherwise DNA would quickly tangle). Uses ATP, makes single-stranded cut, allows one strand to swivel freely around the other.
- RNA primase: DNA polymerase III cannot start a growing chain from scratch; needs a short primer (a few nucleotides) to add to. This is carried out by DNA-dependent RNA primase, makes very short piece of RNA by base-pairing RNA nucleotides with template DNA.
- DNA polymerase : adds new nucleotides at free 3′ends of growing chain, uses base-pairing rules to insert complementary nucleotides (A opposite T, G opposite C, etc.) Can keep on adding indefinitely for millions of nucleotides if not blockage. Also removes RNA primers, fills in gaps by base pairing, inserts new DNA nucleotides to replace RNA primer. (several types of this enzyme)
- DNA ligase: seals any gaps where adjacent nucleotides on one strand have not been covalently joined.
- Note: many gaps result on lagging strand (see below), so lots of need for enzymes (5) and (6).
Leading and Lagging strands
- Since two strands in DNA are antiparallel, new DNA must be synthesized in opposite directions on the two template strands.
- But overall, DNA must unwind in one direction (at replication fork), overall DNA synthesis has one direction.
- No problem for the strand growing in same direction as unwinding = leading strand. Can make one long, continuous piece of DNA
- Big problem for strand growing in opposite direction to unwinding = lagging strand; must grow away from unwinding. As new template is opened up by DNA unwinding, will have to start a new copy.
- In fact, just this situation was discovered experimentally by Okazaki; found many short DNA fragments newly synthesized from lagging strand = Okazaki fragments. Must be joined together by DNA ligase to make continuous DNA strand.
DNA repair
- Any damage to DNA would be lethal. Cells often spend much more energy repairing DNA than synthesizing it.
- Correcting damage due to enviromental effects
§ Example: UV light –> thymine dimers. Energy in UV links thymine where it occurs side-by-side on one strand of DNA, screws up the ability of this bit of DNA to serve as template for replication or for correct reading of proteins.
§ One good 4-hour day at beach —> 10 UV-induced errors in DNA of every skin cell
§ Your skin cells spend lots of energy patrolling DNA, detecting such errors, cutting them out, and using the remaining good strand as a template for repair synthesis.
Correcting errors during replication (proofreading)
§ When new DNA is synthesized, occasional errors in base pairing occur with frequency ~ 1 in 10,000 base pairs
§ If not corrected, could lead to mutations, loss of functions, loss of competitiveness, evolutionary weeding out.
§ Proofreading carried out by DNA polymerases enzymes; if base mismatch spotted, cut out new bases (keep track of which is template strand and which is new strand during replication), resynthesize copy strand from that neighborhood of template.
Transcription and Translation |
|
|||
|
|
||||
|
|
||||
Last revised: Friday, October 15, 1999
Reading: Ch. 17 in text
Note: These notes are provided as a guide to topics the instructor hopes to cover during lecture. Actual coverage will always differ somewhat from what is printed here. These notes are not a substitute for the actual lecture!
Copyright 1999. Thomas M. Terry
The Expression of Genetic Information: an Overview
- All cells contain enormous amounts of DNA. Even the smallest known cell, a bacterium named Mycoplasma genitalium, contains nearly 500,000 base pairs (500 kilo base pairs, or 500 kbp).
- What do cells do with all this information? In bacteria (the simplest cells), DNA serves two major functions:
- encoding structural information that can be converted into RNA and (usually) thence into protein sequence.
- encoding regulatory signals that allow certain proteins to decide where to begin or terminate reading DNA
- In eukaryotic cells, where DNA also has to undergo condensation into chromosomes and mitotic or meiotic events, DNA also contains specialized sequences used for centromeres, telomeres, and other functions.
- The "central dogma" of molecular biology: information flows from nucleic acids to proteins, not the reverse:
DNA —-> RNA —-> polypeptides (proteins)
View graphic summary of information flow
- Transcription = the process of making RNA from DNA templates
- Translation = the process of making polypeptides
- View example of how information is coded from DNA to peptide
Transcription: the Synthesis of RNA
Work through From Gene to Protein: Transcription at The Biology Place..
Structure of RNA
- Components: Ribose, Phosphate, A, C, G & U.
- View RNA components (from The Biology Place)
- U has same base pairing properties as T (forms U=A base pairs)
- RNA is not double stranded (except in some viruses)
- RNA can have extensive "hairpin" loops
- RNA can have modified bases (after transcription) — find unusual bases such as inosine, pseudouridine. These still have base pairing properties, and contribute to stability of molecule,
- Messenger RNA has half-life of only 3 minutes in bacteria, so cell must constantly make new messages to make new proteins– allows rapid adaptation to new environments.
- Eucaryotic RNA is controlled very differently. RNA synthesized in nucleus, modified (to be discussed), and exported to cytoplasm before it is translated.
Types of RNA
- messenger RNA — carries codons to RNA
- ribosomal RNA — part of ribosome structure, catalyzes peptide bond formation
- transfer RNA — set of small RNAs, transport amino acids to ribosome for incorporation into growing polypeptides
Transcription Process
RNA polymerase enzyme
- View animation of beginning of transcription (from The Biology Place.).
- opens up DNA helix for short stretch (~ 15 base pairs)
- selects one of two strands as template strand
- RNA synthesized in 5′ to 3′ direction
- RNA synthesis begins at promoters: sites on DNA that are recognized as "start" signals for RNA synthesis.
- Terminators: regions where RNA synthesis stops, RNA is released from DNA.
- View animation of transcription from start to finish (from The Biology Place.).
Translation: the Synthesis of Proteins
- View animation of translation process from Univ. of Virginia
- Work through The Translation process at The Biology Place
role of mRNA
- carries codons (3-nucleotide sequences) arranged in linear fashion that code for amino acids
- also carries signals needed to tell how to recognize ribosomes, start and stop signals for decoding protein
- leader sequence on small ribosome subunit binds to complementary sequence on mRNA, allows initial formation of RNA-ribosome complex.
- View RNA
role of ribosome
- acts as a "decoding box" or "tape player" for the information in mRNA
- two parts: a small subunit and a large subunit. These are separated except when attached to m-RNA
- ribosomes contain a set of ribosomal proteins and several types of ribosomal RNA (r-RNA)
- ribosomes catalyze the formation of peptide bonds; intially thought to be due to protein activity (enzyme), but now known to be due to RNA catalytic activity (ribozyme)
- View ribosome
role of tRNA
- structure: 4 loops, anticodon, AA binding site
- View model of tRNA
- ~ 60 types in bacteria (>100 in mammals)
- only 73-93 nucleotides long
- some bases modified after transcription; form "funny bases" like pseudouridine.
- extensive hairpin loops
- anticodon site: recognizes codon on mRNA
- Activation of tRNA: adding amino acids
- requires special enzyme: AA-tRNA activating enzymes
- ATP required, forms AA-AMP + PP, then AA-tRNA + AMP
- View animation of activation process
Initiation of Translation
- small ribosomal subunit initiates binding to mRNA
- locates 5′ end of mRNA
- small subunit ribosome finds first AUG codon = start codon
- large ribosome binds
- tRNA carries the amino acid methione to first position
- view animation
Elongation of Translation
- 2 adjacent sites on ribosome: P (Peptide) and A (Amino Acid) site
- A site accepts a new tRNA-AA
- P site holds existing chain
- peptide transferred from P site tRNA to A-site AA
- enzyme activity is in ribosomal RNA (ribozyme)
- View animation
- also required: Energy (GTP) and elongation factors
Termination of Translation
- reach a "stop codon" UAG, UAA, or UGA
- View animation
- no t-RNAs bind
- instead, specific release factors required
- Net cost of translation: 4 phosphate bonds/amino acid added!
The Genetic Code
- View Genetic Code table
- 64 possible codons (3-letter nucleotide sequences): AAA, AAC, etc.
- 60 codons serve as straightforward signals for amino acids
- Some amino acids coded by a single codon
- Some amino acids coded by as many as six different codons (redundancy)
- One codon serves as universal "start": AUG (memnonic: "A, you go!")
- Three codons serve as "stop" signals: UAG, UAA, UGA (memnonic: "You are gone, You all away, You go away")
Universality
- originally thought all organisms use identical codons
- But mitochondria of eukaryotes (except plants) use slightly different assignments for a few codons. Examples:
- UGA = stop (univ), or amino acid Tryptophan (mitochondria from yeast, protozoans, mammals)
- AUA = Isoleucine (univ), or Methinonine (mitochondria from yeast, protozoans, mammals)
Gene organization in Eukaryotes
The coding potential of human DNA
- human DNA contains 6 x 109 base pairs/cell = 6,000,000 kb pairs
- compare to 4700 kb pairs/E. coli, a very sophisticated bacterium. Human DNA is more than 1000x bigger!
- If all human DNA coded for proteins, would have enough for roughly 5 million different proteins
- But currently only know ~ 3000 human proteins, and estimates as to how many we truly have range from 10,000 to 100,000
- In fact, less than 5% of human DNA codes for protein!
- What does the rest of the DNA do?
Functions of human DNA
- Coding for proteins. Eukaryotic genes are organized in peculiar fashion:
- Exons: (short for "expressed") — regions of DNA that code for amino acids.
- Introns: (short for "intervening" or "interrupting") — regions of DNA inside a gene, located in between exon regions, but not coding amino acids
- When RNA is transcribed from a gene, it initally contains both introns and exons, and cannot be called "messenger RNA" yet because the message is interrupted. Introns must be removed by "cut-and-paste", called RNA splicing.
- View animation of RNA splicing in eukaryote (from The Biology Place.).
- snRNPs ("snurps") = small ribonucleoprotein particles, found in nucleus. Composed of RNA and a few proteins. snRNPs associate to form a Spliceosome, which locates the junction of intron and exon, specifically cuts at this junction, and joins the cut ends of exons to form messenger RNA.
- Ribozymes: the enzymatic activity of spliceosomes was initially thought to be in the protein. However, now known to be on RNA; first example of catalytic RNA (called ribozyme for as opposed to enzyme, which is protein).
- Note: almost all genes in eukaryotes contain intron/exon organization. In some cases, amount of intron can be much larger than amount of exon DNA.
- Evolutionary importance of introns: since many proteins consist of several domains with different functions,
- Multigene Families: some genes are represented by more than one copy, typically for products needed in large quantity by cell.
- Example 1: ribosomal genes (for ribosomal RNA). Copies of the same gene are clustered together in enormous number (hundreds of thousands of identical gene copies).
- Example 2: histone genes (for proteins that bind to DNA to make chromatin). Family of histone proteins is represented many times.
- Pseudogenes: examples of multigene families where some copies of the gene have mutated to the point where they no longer function at all in the cell.
- Example: globin gene family. In humans, find several slightly different globin genes that produce the hemoglobin molecules needed by fetus, embryo, and adult. But also find a cluster of genes nearly identical in base sequence, but never expressed in the life of a human.
- Explanation: at some time in evolutionary past, globin genes were duplicated (by gene transposition). One cluster retained the job of making functional hemoglobin. The other cluster mutated so that promoter site no longer could be recognized by RNA polymerase. Result = this gene cluster now serves no purpose, cannot make any RNA or protein, but provides evidence of an evolutionary past. Called a pseudogene because it looks like a gene, but doesn’t function.
- Repetitive sequence DNA. Some regions of DNA contain short sequences repeated many thousands of times = "tandem repeats". No coding function at all.
- Example 1: "satellite" DNA. Sequence such as ACAAACT repeated again and again (producing …ACAAACTACAAACTACAAACTACAAACTACAAACTACAAACT…). These regions appear to be located where the centromere forms, so this sequence must have mechanical properties that allow recognition by kinetochore and mitotic spindle.
- Example 2: "telomeric" DNA. Sequences such as TTAGGG repeated over and over, 250-1500 times. Found at the ends of linear chromosomes (telomeres) where RNA primase (needed to prime the synthesis of new DNA) cannot work on lagging strand. Telomeric DNA acts like a "cap" on the end of the chromosome. If didn’t have this, then DNA would lose a bit every replication, chromosome would gradually get shorter.
The normal human chromosome complement
We already had a look at chromosomes in lecture 1 and the following terms should be familiar:
46 XX and 46 XY
Human cells are diploid, that is they contain two of (almost) every gene. They do so by having two copies of each autosome, (chromosomes 1-22) and two sex chromosomes (either XX or XY). The normal human karyotype when viewed down the microscope at mitotic metaphase is thus either 46 XX or 46 XY. (Meaning 46 coloured blobs, two of which are XX or XY).
This picture shows a normal male mitotic metaphase spread next to an interphase nucleus.
The primary constriction is the centromere, visible in the above picture as the point where the two chromatids remain attached, but also containing the kinetochore, the point of spindle attachment. Secondary constrictions are usually only found as the stalks connecting the short arms of the two groups of acrocentric chromosomes.
banding
When microscopes were improved to the point that the human karyotype could be reliably discerned (in the 1950s) the chromosomes could be grouped on the basis of their relative sizes and the relative lengths of their two arms, i.e. the positions of their centromeres. Now, banding techniques make it possible to identify each chromosome.
If chromosomes are treated briefly with proteinase before staining then each chromosome has a characteristic banding pattern.
The two chromosome arms are refered to as p and q (short and long respectively). Bands are numbered from the centromere. As microscopes improved the coarse banding patterns were refined by the addition of further levels of numbering so that band 9q34.1 means the 1st subband of the 4th subband of the 3rd band of the long arm of chromosome 9! Some regions of the chromosomes are uniformly staining and late replicating. They contain few (if any) genes and are composed primarily of tandemly repeated DNA sequences (satellite DNA). These are called constitutive heterochromatin. (The inactive X chromosome in female cells is also late replicating and is called facultative heterochromatin.) Centromeres, the points of attachment of the replicated chromatids to each other and to the mitotic spindle fibres are all within constitutive heterochromatin.
FISH
No, not this sort, but "Fluorescent In Situ Hybridisation".
The technique of DNA-DNA hybridisation has been discussed in lecture 5 under the heading of Southern blotting. The ability of a single stranded DNA molecule to find and bind to its complementary strand is pretty amazing. In FISH it is exploited to the utmost. It is possible to visualise by hybridisation, the site of a fragment of DNA of as little as 1 - 2 kb (but more usually 40 - 50 kb) at an efficiency approaching 100%. The probe molecule is labelled with a hapten such as biotin. The biotin is located with streptavidin. The streptavidin is located with antibodies. A fluorescent dye may be conjugated to the streptavidin and to the antibodies. When the spread chromosomes are illuminated by a UV lamp, a point of fluorescence can be seen where the probe / streptavidin / antibody / fluorescent dye multilayer sandwich has built up. From three to five layers of fluorescent antibodies are built up to amplify the signal.
For examples click here
chromosome painting
Complex probes made from entire chromosomes can be made. In this way the presence that chromosome can be ascertained and also whether it has been subject to any rearrangements. This picture shows a probe made from chromosome 22 which has been used to "paint" a cell line which has a small mysterious extra chromosome. The probe hybridises to this as well as to the two normal chromosome 22s showing that the small "marker" chromosome is derived fromm chromosome 22.
prenatal diagnosis
If there is some reason to suspect that an embryo may have abnormal chromosomes, for instance maternal age or past history of early spontaneous abortions, it is usual to check.
- At about 12 - 14 weeks of gestation it is possible to obtain foetal cells by amniocentesis. In this technique a needle is inserted into the amniotic sac and fluid is drawn off. Foetal cells, amniocytes, are suspended in the fluid and these can be cultured and their metaphase chromosomes examined. One of the commonest chromosome abnormalities is Down syndrome, the figure links to the relevant passage later in this lecture.
- At 9-10 weeks of gestation, it is possible to aspirate via the cervix, a small amount of the placental tissue, the technique of chorionic villus sampling. This tissue can be cultured and chromosomes prepared.
- In fertility clinics embryos are often conceived by artificial insemination. A single, totipotent, cell from an 8 cell stage embryo can be examined directly and the information can be used to decide on which embryo to reintroduce into the mother.
relationship to other organisms
If a paint is made from a human chromosome it can be applied to the chromosomes of other species. This image is of marmoset chromosomes to which a human chromosome 8 paint has been applied. This shows homology with the short arm of marmoset chromosome 13, and the whole of marmoset chromosome 16. Sherlock et al., (1996) Homologies between human and marmoset (callithrix jacchus) chromosomes revealed by comparative chromosome painting. Genomics 33: 214-9
numerical abnormalities
One of the commonest mutations is a change in the chromosome number but it is also one of the most damaging occurences. Very few mutations which cause visible changes in the autosomes are compatible with life. Conor and Ferguson-Smith make the analogy that if the length of the human haploid genome was drawn stretching from London to New York, the smallest visible deletion (about 4Mb) would represent about an 8 km gap and that on this scale, the average gene would be about 30 m long. So even the smallest gap will usually contain many genes. About 20% of conceptions have some sort of chromosomal disorder but because of the lethal effects of such disorders, the number actually born is only about 0.6%.
|
chromosome abnormalities in early spontaneous abortions |
|
|
Defect |
frequency |
|
triploidy |
10% |
|
tetraploidy |
5% |
|
trisomy |
30% |
|
Turner syndrome (45 X) |
10% |
|
other |
5% |
|
Total |
60% |
A wonderful resource for the next section is the University of Tokyo Medical School where someone has laboured long and hard to make all sorts of moving images to explain chromosome rearrangements (and lots of other things too, BROWSE….)
euploidy
Euploidy is the category of chromosome changes which involve the addition or loss of complete sets of chromosomes.
- triploidy
The possession of one complete extra set of chromosomes is usually caused by polyspermy, the fertilisation of an egg by more than one sperm. Such embryos will usually spontaneously abort.
- tetraploidy
This is usually the result of a failure of the first zygotic division. It is also lethal to the embryo. Any other cell division may also fail to complete properly and in consequence a very small proportion of tetraploid cells can sometimes be found in normal individuals.
aneuploidy
Aneuploidy is the category of chromosome changes which do not involve whole sets. It is usually the consequence of a failure of a single chromosome (or bivalent) to complete division.
All autosomal monosomies are lethal in very early embryogenesis. They do not even feature in the table above because they abort too early even to be recognised as a conception.
The incidence of trisomy 21 rises sharply with increasing maternal age.
|
|
||||||||||||||||||||||||
|
||||||||||||||||||||||||
Most cases arise from non disjunction in the first meiotic division, the father contributing the extra chromosome in 15% of cases. A small proportion of cases are mosaic and these probably arise from a non disjunction event in an early zygotic division. About 4% of cases arise by inheritance of a translocation chromosome from a parent who is a balanced carrier. The symptoms include characteristic facial dysmorphologies, and an IQ of less than 50. Down syndrome is responsible for about 1/3 of all cases of moderate to severe mental handicap.
- Trisomy 13
The incidence is about 1 in 5000 live births. 50% of these babies die within the first month and very few survive beyond the first year. There are multiple dysmorphic features. Most cases, as in Down’s syndrome, involve maternal non-disjunction. Again, a significant fraction have a parent who is a translocation carrier.
- Trisomy 18 (Edward’s syndrome)
Incidence ~1 in 3000. Again most babies die in the first year and many within the first month.
- sex chromosome aneuploidies
Because of X inactivation and because of the paucity of genes on the Y chromosome, aneuploidies involving the sex chromosomes are far more common than those involving autosomes.
The incidence is about 1 in 500 female births but this is only the tip of the iceberg, 99% of Turner syndrome embryos are spontaneously aborted. Individuals are very short, they are usually infertile. Characteristic body shape changes include a broad chest with widely spaced nipples and may include a webbed neck. IQ and lifespan are unaffected.
The incidence at birth is about 1 in 1000 males. Testes are small and fail to produce normal levels of testosterone which leads to breast growth (gynaecomastia) in about 40% of cases and to poorly developed secondary sexual characteristics. There is no spermatogenesis. These males are taller and thinner than average and may have a slight reduction in IQ. Very rarely more extreme forms of Kleinfelter’s syndrome occur where the patient has 48, XXXY or even 49, XXXXY karyotype. These individuals are generally severely retarded.
- 47, XYY
Incidence 1 in 1000 male births. May be without any symptoms. Males are tall but normally proportioned. 10 - 15 points reduction in IQ compared to sibs? More common in high security institutions than chance would suggest? Strangely, although they are fertile they do not seem to transmit the either this condition or Kleinfelter’s syndrome.
About one woman in 1000 has an extra X chromosome. It seems to do little harm, individuals are fertile and do not transmit the extra chromosome. They do have a reduction in IQ comparable to that of Kleinfelter’s males.
structural aberrations
From time to time a cell sustains damage from for instance an energetic cosmic ray particle passing through and leaving behind a trail of ionisation. This may lead to chromosome breakage. The repair systems in the nucleus will do their best to make good the damage and if this involves only one break they may be able to do so with no errors. However, if more than one break has occured they may become rejoined in the wrong combinations. This can lead to one of a spectrum of possibilities.
balanced rearrangements
Rearrangements where there is no visible loss or gain of genetic material are balanced. They include:
In an inversion, a piece of chromosome is lifted out, turned arround and reinserted. If this includes the centromere then the inversion is termed pericentric. If it excludes the centromere then it is a paracentric inversion. The two have slightly different genetic consequences. 1% of the UK population are heterozygous for a pericentric inversion of chromosome 9. This is absolutely without genetic consequences.
At meiosis hetrozygous inverted chromosomes have difficulty pairing and can only do so by the formation of a loop. If a recombination event occurs within the inverted loop the consequence will be a duplication and a deletion, see the gametes drawn at the bottom of the figure. If the inversion is paracentric then the centromere itself may be duplicated (which gives rise to a dicentric fragment which will try to go to both poles at anaphase I with dire consequences) or deleted (giving rise to an acentric fragment which gets left behind on the metaphase plate).
- translocations
In a balanced translocation there is no net gain or loss of chromosomal material, two chromosomes have been broken and rejoined in the wrong combination. The figure shows a translocation between the imaginary chromosomes "M" and "N". Balanced reciprocal translocation is unlikely to have any severe consequence for the cell because, even if one of the breakpoints lies within a gene, most mutations are recessive (lecture 6).
It is possible that an oncogene may be activated by the translocation and this can lead to cancer. The classic example is the chromosome 9 / chromosome 22 reciprocal translocation in chronic myeloid leukaemia. (Discussed in the final lecture).
Translocations can however give rise to difficulties with reproduction. During the first meiotic prophase, the chromosomes align in pairs to form bivalents. However, a heterozygote for a reciprocal translocation forms instead a ‘tetravalent’. The chromosomes will segregate in the first meiotic division. Many possibiliites are open, only one, the one shown in the figure, leads to balanced gametes. This is known as "alternate segregation" where the two intact chromosomes must both move to one pole and the two translocation chromosomes must both move to the other.
unbalanced rearrangements
Deletions may either be either interstitial or terminal. If big enough to be visible a deletion must be removing many genes and will probably give rise to a severe phenotype. See above. An example of an interstitial deletion is the 15q- deletion which causes either Angelman or Prader-Wili syndromes. Many independent deletions in this region do indeed remove many genes including the two responsible for the two syndromes. You will find many more examples, try for instance searching OMIM with the acronym WAGR (which stands for Wilms tumour, Aniridia, ambiguous Genitalia and mental Retardation). See also the table on page 129 of Connor and Ferguson-Smith
Terminal deletions have only one breakpoint, they extend to the telomere. For example the karyotype shown on the right is of a baby with Cri du chat syndrome in which a small part of the distal region of the short arm of chromosome 5 is deleted. Babies with this syndrome have a combination of symptoms which include pinched facial features, mental retardation and developmental delay. The characteristic feature, for which the syndrome is named is a "mewing" cry. The charateristic cry may be separated genetically from the facial dysmorphology and developmental delay, since a small terminal deletion may have the cry only whereas a larger deletion extending further towards the centromere will include the genes whose hemizygosity is responsible for the other syptoms.
translocations
An unbalanced translocation may arise spontaneously and is also likely to arise as an offspring of a balanced carrier. There are likely to be symptoms which may be severe. Their exact nature will be unpredictable. Such translocation chromosomes are extremely useful to science in helping to pinpoint genes resposible for the conditions expressed by their bearers.
Robertsonian translocations are a special case of ‘almost balanced’ translocations. Robertsonian translocations involve any two out of chromosomes 13, 14, 15, 21 and 22. These chromosomes are all acrocentric, that is, the centromere is very close to one end. The short arms contain few, if any, genes except for many tandemly repeated copies of the ribosomal RNA genes. Every diploid cell thus contains 10 copies of the block of repeated genes. A Robertsonian translocation is a fusion between the centromeres of two of these chromosomes with loss of the short arms forming a chromosome with two long arms, one derived from each chromosome. The loss of the short arms does not matter, each cell still has eight copies of the rRNA gene block and that, apparently, is enough. In the same way as balanced reciprocal translocation carriers have difficulties at meiosis in ensuring the correct segregation of the chromosomes to make a balanced set, so too do Robertsonian translocation carriers. In their case the chromosomes pair in meiotic prophase to form a trivalent and balanced gametes will only be formed when the translocation chromosome goes to the opposite pole to both of the normal chromosomes. Robersonian carriers therefore suffer a similar reduction to their fertility as do carriers of reciprocal translocations and couples in which one of the partners has a translocation may have a number of early spontaneous abortions. Robertsonian translocations involving chromosome 21 possess a special problem of their own, one of the possible unbalanced gametes will contain effectively two copies of chromosome 21 (when the translocation chromosome and chromosome 21 segregate to the same pole). They are thus at risk of producing a baby with Down syndrome.
- isochromosomes
A chromosome can split "the wrong way" in mitosis (or meiosis II) so that both long arms remain attached and move to one pole, and both short arms do likewise moving to the other pole. The consequence is the formation of an isochromosome. These are simultaneously duplicated for the genes in the retained arm and deleted for the genes in the other. The prognosis is poor except for iXq (isochromosome of the long arm of the X).
- ring chromosomes
A mutation event which removes both telomeres can be repaired by sealing the ends together forming a ring chromosome. This will be deleted for genes at both ends of the chromosome. the symtoms will depend on the extent of the deletion. Surprisingly, ring chromosomes are mitotically stable. One might expect them to get hopelessly entangled during DNA replication and at the very least to be concatenated when the time comes to seperate to the two poles. While this undoubtedly happens, it is not a frequent occurence.
Recommended reading
The topics include:
- The normal human chromosome complement
- FISH and chromosome painting
- Autosomal and sex chromosome aneuploidies
- Balanced and unbalanced structural rearrangments
Reading:
- Lewis Chapter 11 Another MUST READ chapter!
- Mange and Mange Chapter 2 (pp24 - 27) but especially Chapters 13 and 14 - two very interesting and well written chapters. Well worth reading.
- Mueller and Young Chapter 17 Drier account - but packed with facts.
- Jorde et al. Chapter 6
- Thompson McInnes and Willard Chapters 9 and 10 Well written and containing all the information and more.
- Connor and Ferguson-Smith Chapters 6 and 13 Chapter 6 is particularly clear, 13 is similar in content to Mueller and Young.
SAQs
- The Xg blood group gene, XG is located near the tip of the short arm of the X chromosome, just distal to the genes for Kallmann syndrome and steroid sulphatase (STS) gene. It has two alleles, one of which, XG+, codes for the production of an antigen on the surface of red blood cells, the other, XG-, does not. A two year old boy, whose mother is Xg+, is unable to smell anything, has hypogonadism, a small penis and ichthyosis. On testing he turns out to be Xg-. What possible cause can you suggest? What genetic tests might you carry out?
- If heterozygosity for an inversion chromosome leads to problems with reproduction, would homozygosity be likely to give rise to worse problems?
- Patients with the karyotype 46, X iXq have Turner’s syndrome. Why?
4. (CHOMOSOME MUTATION: CHANGES IN CHROMOSOME STRUCTURE)
5. LECTURE NOTES
6. I. Background
7. A. Chromosomal mutations are processes that result in rearranged chromosome parts,
8. abnormal numbers of individual chromosomes, or abnormal numbers of chromosome
9. sets. The resulting products are also known as chromosomal mutations.
10. B. For our purposes here, we will be talking about alterations in large regions of the
11. chromosome spanning numerous genes
12. C. Abnormalities from chromosomal mutations are frequently due to:
13. 1. change in gene number (balance)
14. 2. change in gene location
15. 3. break internal to a gene
16. D. Can occur in somatic cells, germinal cells, and gametes
17. E. How can you detect a chromosomal mutation? cytogenetics
18. 1. Cytological examination of the actual chromosomes
19. 2. Genetic analysis of inheritance
20. II. Physical features of the chromosomes
21. A. Size
22. B. Centromere position (appears constricted under microscope)
23. 1. Telocentric (at one end of the chromosome)
24. 2. Acrocentric (off center on the chromosome)
25. 3. Metacentric (in the center of the chromosome)
26. B. Arm length: centromere to the end defines an arm (p = short arm and q = long arm)
27. C. Nucleolar organizer position
28. 1. Nucleoli = intranuclear organelles that contain rRNA (appears as dark spot
29. under microscope)
30. 2. Number of nucleoli ranges from 1 to many per chromosome set
31. 3. Position of nucleolus is next to constriction of the chromosomes called
32. nucleolar organizers which themselves have specific chromosome locations
33. D. Chromomere patterns (beadlike, localized thickening along the chromosomes during
34. prophase)
35. E. Heterochromatin patterns
36. 1. Constitutive heterochromatin is highly condensed chromosomal regions that
37. are for the most part genetically inert and are found in particular chromosomal
38. regions
39. 2. Detected by staining with chemicals (such as Feulgen) that react with DNA as
40. very dense regions of staining
41. F. Banding patterns due to special chromosome staining procedures
42. 1. Specific stains reveal specific bands at specific chromosomal sites
43. a) Quianacrine hydrochloride Q bands
44. b) Giemsa stain G bands
45. c) Reversed giemsa R bands
46. 2. Specialized case of polytene chromosomes in Drosophila
47. E. Karotype = the entire metaphase chromosome complement of individual
48. F. Physical characteristics of chromosomes are useful for detecting chromosome
49. mutations such as chromosome rearrangements including deletions, duplications,
50. inversions, and translocations.
51. III. Deletions (loss of a chromosomal segment)
52. _A_B_C___o___D_E_F___ _A_C___o___D_E_F___
53. A. Types
54. 1. Interstitial (Not at the end of the chromosome)
55. 2. Terminal (Near the end of the chromosome)
56. B. Deletions require two breaks in the chromosome followed by loss of the
57. chromosomal segment and rejoining of the ends.
58. C. The deleted fragment is acentric (without a centromere) and will be lost upon
59. multiple rounds of cell division.
60. D. In meiosis I cells heterozygous for the deletion, chromosomes line up normally
61. except that region corresponding to deletion forms a “loop formed to get proper
62. alignment of the homologous chromosomes..
63. E. Effect of multigenic deletions
64. 1. Homozygous for multigenic deletion = usually lethal.
65. 2. Heterozygous for mutigenic deletion = frequently lethal because
66. a) Unmasking of lethal allele on homologous chromosome without the
67. deletion
68. b) Upset balance of gene number
69. F. Detection
70. 1. Genetic
71. a) Failure of homozygotes to survive
72. b) Inability of the mutation to revert back to wild type
73. c) Recombination frequency between the genes flanking the deletion is
74. lower than in the wild type
75. d) Unmasking of a recessive allele present on the homologous
76. chromosome without the deletion (pseudodominance of the recessive
77. allele)
78. 2. Cytological
79. a) Deletion loop in meiosis
80. b) Change in banding patterns
81. G. Using deletions to map genes
82. 1. Deletion mapping
83. a) Cross a new recessive mutant with a set of deletion mutants of known
84. map location. The new mutation will show pseudodominance when
85. heterozygous for the deletion that contains the region to which the new
86. mutation maps. See figure 8-8 in text.
87. b) Cross a new mutant suspected of containing a deletion with a set of
88. recessive mutants of known map location. Look for the pseudodominance
89. effect which indicated that your putative deletion is in the same area as the
90. gene that is showing pseudodominance
91. 2. In situ hybridization
92. Add a radioactively labeled gene of interest to a chromosome deletion set
93. and look for the presence or absence of radioactivity for each deletion.
94. The chromosome deletions that do no hybridize to the radioactive gene
95. probe are deleted for the region that contains the gene of interest.
96. IV. Duplications (presence of two copies of a chromosomal region)
97. _A_B_C___o___D_E_F___ _A_B_C_B_C___o___D_E_F___
98. OR
99. _A_B_C___o___D_E_F___ _A_B_C_C_B___o___D_E_F___
100. A. Types
101. 1. tandem (adjacent to each other in same order)
102. 2. reverse tandem (adjacent to each other in reverse order)
103. 3. nontandem (at a different chromosomal location)
104. B. Tandem duplications can occur due to unequal crossing over where homologous
105. chromosomes pair inaccurately during meiosis I
106. (Deletion)
107. (Duplication)
108. C. Nontandem duplications may result from crossing over during meiosis within
109. segments of the chromosome that contain inversions or translocations (see later).
110. D. In meiosis I cells heterozygous for the duplication, chromosomes line up normally
111. except that region corresponding to duplication forms a “loop” formed to get proper
112. alignment of the homologous chromosomes. Also, asymmetric pairing within the
113. duplicated region may occur during meiosis I, leading to unequal crossover.
114. (from An Introduction to Genetic Analysis, 6th ed. by Griffiths et al. (W. H. Freeman and Company)
115. E. Effect of duplications
116. 1. Duplications are rare.
117. 2. Heterozygous for duplication = can be lethal because of imbalance generated
118. by extra copies of the duplicated region.
119. 3. Homozygous for duplications is unknown in medical genetics.
120. F. Detection is difficult. Cytology is the main tool (change in bands and duplication
121. loop in meiosis I)
122. G. Duplications have been proposed to be important for evolution because they provide
123. an extra copy of genes that can then undergo mutation while still leaving the original
124. gene unaffected.
125. V. Inversions (flipping of chromosomal segment relative to the rest of the chromosome)
126. _A_B_C D E___o___F_G H__ _A_D_C B E___o___F_G H__
127. OR
128. _A_B_C___o___D_E_F___ _A_E_D___o___C_B_F___
129. A. Types
130. 1. Paracentric – centromere outside the inversion
131. 2. Pericentric – centromere inside the inversion
132. B. Inversions require two breaks in the chromosome followed by a 180rotation of the
133. chromosomal segment and rejoining of the ends.
134. C. In meiosis I cells heterozygous for the inversion, inversion loop is formed to get
135. proper alignment of the homologous chromosomes.
136. 1. Paracentric
137. (from An Introduction to Genetic Analysis, 6th ed. by Griffiths et al. (W. H. Freeman and Company)
138. 2. Pericentric
139. (from An Introduction to Genetic Analysis, 6th ed. by Griffiths et al. (W. H. Freeman and Company)
140. D. In meiosis I cells homozygous for the inversion, crossover is normal but linkage map
141. shows inverted gene order.
142. E. Effects of inversions are negligible because there is no change in the genetic material.
143. However, those heterozygous for inversions produce abnormal meiotic crossover
144. products and possibly abnormal progeny (if they survive at all).
145. F. Detection
146. 1. Genetic – recombinant progeny are usually not recovered from heterozygotes
147. 2. Cytological
148. a) If the duplication is pericentric, the arm lengths change.
149. b) Change in the banding pattern
150. c) Dicentric bridge in meiosis for paracentric inversion
151. IV. Translocations (movement of a chromosomal segment from one location to another)
152. _A_B_C___o___D_E__ and _G_H_I___o___J_K__
153.
154. _A_B_C___o___J_K__ and _G_H_I___o___D_E__
155. A. Types
156. 1. Reciprocal (exchange of segments)
157. 2. Nonreciprocal (1 segment moves to a new location without an exchange)
158. B. Reciprocal translocations require two breaks in two different chromosomes followed
159. by rejoining of the ends.
160. C. In meiosis I cells heterozygous for the deletion, cross conformation forms to get
161. proper alignment of the homologous chromosomes. Showing only meiosis I on the next
162. page:
163. A B C D E G H I J K
164. A B C J K G H I D E
165. A B C
166. D E
167. I H G
168. D E
169. A B C
170. J
171. K
172. J
173. K
174. I H G
175. Lining up during Meiosis I
176. Alternate Segregation
177. A B C D E G H I J K
178. A B C J K G H I D E
179. Adjacent-1 Segregation
180. A B C D E
181. G H I J K A B C J K
182. G H I D E
183. wild type
184. translocated
185. Deleted for JK
186. Duplicated for DE
187. Deleted for DE
188. Duplicated for JK
189. OR
190. Heterozygous for
191. translocation
192. (In most cases, these gametes form
193. nonviable progeny even when mated with
194. wild type.)
195. D. Effect of translocations
196. 1. Semisterility due to adjacent segregation in meiosis
197. 2. Position effects: altered expression of a gene when it is moved to a new
198. location
199. E. Detection
200. 1. Genetic
201. a) Semisterility
202. b) Apparent linkage of genes on separate chromosomes
203. c) Position effects
204. 2. Cytological
205. a) Can change the location of the centromere
206. b) Change in the size of the chromosome
207. c) Cross formation in meiosis
Genetic disorder
From Wikipedia, the free encyclopedia
(Redirected from Single-gene disorder)
Jump to: navigation, search
For a non-technical introduction to the topic, see Introduction to genetics.
A genetic disorder is a condition caused by abnormalities in genes or chromosomes. While some diseases, such as cancer, are due to genetic abnormalities acquired in a few cells during life, the term "genetic disease" most commonly refers to diseases present in all cells of the body and present since conception. Some genetic disorders are caused by chromosomal abnormalities due to errors in meiosis, the process which produces reproductive cells such as sperm and eggs. Examples include Down syndrome (extra chromosome 21), Turner Syndrome (45X0) and Klinefelter’s syndrome (a male with 2 X chromosomes). Other genetic changes may occur during the production of germ cells by the parent. One example is the triplet expansion repeat mutations which can cause fragile X syndrome or Huntington’s disease. Defective genes may also be inherited intact from the parents. This can often happen unexpectedly when two healthy carriers of a defective recessive gene reproduce, but can also happen when the defective gene is dominant. Currently about 4,000 genetic disorders are known, with more being discovered. Most disorders are quite rare and affect one person in every several thousands or millions. Cystic fibrosis is one of the most common genetic disorders; around 5% of the population of the United States carry at least one copy of the defective gene. Some types of recessive gene disorder confer an advantage in the heterozygous state in certain environments.[1]
Genetic diseases are typically diagnosed and treated by geneticists. Genetic counselors assist the physicians and directly counsel patients. The study of genetic diseases is a scientific discipline whose theoretical underpinning is based on population genetics.
|
Contents [hide] |
[edit] Single gene disorders
Where genetics are the result of a single mutated gene they can be passed on to subsequent generations in several ways. Genomic imprinting and uniparental disomy, however, may affect inheritance patterns. The divisions between recessive and dominant are not "hard and fast" although the divisions between autosomal and X-linked are (related to the position of the gene). For example, achondroplasia is typically considered a dominant disorder, but children with two genes for achondroplasia have a severe skeletal disorder that achondroplasics could be viewed as carriers of. Sickle-cell anemia is also considered a recessive condition, but carriers that have it by half along with the normal gene have increased immunity to malaria in early childhood, which could be described as a related dominant condition.
[edit] Autosomal dominant
Main article: Autosomal dominant
Only one mutated copy of the gene will be necessary for a person to be affected by an autosomal dominant disorder. Each affected person usually has one affected parent. There is a 50% chance that a child will inherit the mutated gene. Conditions that are autosomal dominant have low penetrance, which means that, although only one mutated copy is needed, a relatively small proportion of those who inherit that mutation go on to develop the disease, often later in life. Examples of this type of disorder are Huntington’s disease, Neurofibromatosis 1, Marfan Syndrome, Hereditary nonpolyposis colorectal cancer, and Hereditary multiple exostoses,which is a high penetrance autosomal dominant disorder.
[edit] Autosomal recessive
Main article: Autosomal recessive
Two copies of the gene must be mutated for a person to be affected by an autosomal recessive disorder. An affected person usually has unaffected parents who each carry a single copy of the mutated gene (and are referred to as carriers). Two unaffected people who each carry one copy of the mutated gene have a 25% chance with each pregnancy of having a child affected by the disorder. Examples of this type of disorder are Cystic fibrosis, Sickle cell anemia(Also Partial Sickle Cell Anemia), Tay-Sachs disease, Spinal muscular atrophy, and Dry (otherwise known as "rice-brand") earwax[2]
[edit] X-linked dominant
Main article: X-linked dominant
X-linked dominant disorders are caused by mutations in genes on the X chromosome. Only a few disorders have this inheritance pattern. Males are more frequently affected than females, and the chance of passing on an X-linked dominant disorder differs between men and women. The sons of a man with an X-linked dominant disorder will not be affected, and his daughters will all inherit the condition. A woman with an X-linked dominant disorder has a 50% chance of having an affected daughter or son with each pregnancy. Some X-linked dominant conditions, such as Aicardi Syndrome, are fatal to boys, therefore only girls have them (and boys with Klinefelter Syndrome). Other examples of this type of disorder are Hypophosphatemia, Aicardi Syndrome, and Chokenflok Syndrome.
[edit] X-linked recessive
Main article: X-linked recessive
X-linked recessive disorders are also caused by mutations in genes on the X chromosome. Males are more frequently affected than females, and the chance of passing on the disorder differs between men and women. The sons of a man with an X-linked recessive disorder will not be affected, and his daughters will carry one copy of the mutated gene. With each pregnancy, a woman who carries an X-linked recessive disorder has a 50% chance of having sons who are affected and a 50% chance of having daughters who carry one copy of the mutated gene.Examples of this type of disorder Hemophilia A, Duchenne muscular dystrophy, Color blindness, Muscular dystrophy and Androgenetic alopecia.
[edit] Y-linked
Main article: Y linkage
Y-linked disorders are caused by mutations on the Y chromosome. Only males can get them, and all of the sons of an affected father are affected. Since the Y chromosome is very small, Y-linked disorders only cause infertility, and may be circumvented with the help of some fertility treatments. Examples are Male Infertility.
[edit] Mitochondrial
Main article: Mitochondrial disease
This type of inheritance, also known as maternal inheritance, applies to genes in mitochondrial DNA. Because only egg cells contribute mitochondria to the developing embryo, only females can pass on mitochondrial conditions to their children. Examples of this type of disorder are Human mitochondrial genetics, and Leber’s Hereditary Optic Neuropathy.
[edit] Multifactorial and polygenic disorders
Genetic disorders may also be complex, multifactorial or polygenic, this means that they are likely associated with the effects of multiple genes in combination with lifestyle and environmental factors. Multifactoral disorders include heart disease and diabetes. Although complex disorders often cluster in families, they do not have a clear-cut pattern of inheritance. This makes it difficult to determine a person’s risk of inheriting or passing on these disorders. Complex disorders are also difficult to study and treat because the specific factors that cause most of these disorders have not yet been identified.
On a pedigree, polygenic diseases do tend to “run in families”, but the inheritance does not fit simple patterns as with Mendelian diseases. But this does not mean that the genes cannot eventually be located and studied. There is also a strong environmental component to many of them (e.g., blood pressure).
Objectives
The student(s) will:
- be familiar with the roles of clinical geneticists, genetic counselors and laboratory scientists and how they contribute to patient care,
- be able to find resources about genetic conditions through public databases, web pages, journals, textbooks and genetics departments,
- appreciate the complexity of genetic information,
- appreciate the social, psychosocial, environmental, ethical and legal issues in clinical genetics,
- appreciate the genetic equality of humans of any race,
- develop a non-judgmental attitude towards individuals affected by heritable disease and to appreciate that some genetic diseases represent positive human adaptations to ancient environments,
- be able to identify individuals who may benefit from a genetic consultation based on family history or clinical history,
- be able to explain common genetic conditions and terminology to families and write a referral to a genetic specialist,
- be familiar with the features of Mendelian and mitochondrial inheritance patterns,
- be familiar with some exceptions to common patterns of inheritance (new mutation, X-inactivation, incomplete penetrance),
- understand the concept of multifactorial (polygenic) inheritance and common disorders associated with this mode of inheritance,
- be able to make a three generation pedigree using standard symbols,
- be able to identify and understand the basis of common genetic conditions,
- be able to describe and compare the mechanisms of deformation, malformation and disruption.which result in errors of morphogenesis,
- understand the implications of genetic risk for patients and families,
- appreciate the probabilistic nature of genetic test results, the influence of penetrance on the risk of disease and the concept of genetic susceptibility,
- be aware of health monitoring guidelines for common genetic conditions and be able to implement these into clinical practice,
- appreciate that in the event of severe neonatal illness the differential diagnosis could be a metabolic disorder,
- appreciate that some metabolic disorders can be treated through dietary restriction, supplements and drugs,
- be able to define or describe what is a human chromosome and the modal chromosome number in humans,
- be able to describe the process of mitosis and meiosis,
- be able to describe chromosome aneuploidy and the mechanisms which cause aneuploidy,
- know the clinical consequences of aneuploidy and to be able to describe at least two specific clinical examples,
- be able to describe or define a balanced chromosome rearrangement,
- know the clinical and reproductive consequences of being a carrier of a balanced chromosome rearrangement,
- know the clinical and reproductive consequences of being a carrier of an unbalanced chromosome rearrangement,
- understand the central dogma DNA/RNA/Protein,
- be able to describe the basic structure of a human gene,
- be able to describe genetic mutations which can alter gene function,
- understand the basic definition of locus and allele and the influence of ethnicity, selection and migration on allele frequencies,
- appreciate the differences between molecular diagnostic techniques which can be used to detect disease causing mutations or can infer their presence,
- understand the involvement of genetic mutations in the onset of both sporadic and hereditary forms of cancer,
- know the clinical features which distinguish sporadic versus familial cancer, and
- understand the concept of pharmacogenetics and the differences in pharmacologic responses to drugs which result from genetic variation between individuals.
Case Study 1
Consult I
You are asked to see a 13 year old boy (Sam) in clinic who is affected with a flu-like
illness. He is brought to the clinic by his mother (Mary). Besides the obvious symptoms
of the illness, which turns out to be a sinus infection, you notice that the boy is having
difficulty answering your questions about his school and what sports he likes. Concerned
that this may be a signal of more severe illness you ask the mother if these responses are
typical for her son. The mother admits that her son is developmentally delayed and that
to date a diagnosis or cause has not been identified. This has been a source of frustration
for the family as they don’t know if it could occur again or if there is something they
could be doing to help the boy. A brief examination of the boy is largely unremarkable
except that his face is rather long, he has a high arched palate, crowded teeth and
prominent ears. Since you have had to prescribe antibiotics for the sinus infection you
suggest the mother return to clinic when they have finished the course of medication at
which time you will conduct a more detailed examination and discuss whether further
testing is appropriate.
Consult II
The mother returns to clinic with her son. The sinus infection has been treated
successfully with the antibiotics. Focusing on the issue of the developmental delay in the
son you proceed with the examination. You confirm your original assessment of the
facial features and in addition discover that the child also exhibits hypermobile joints,
pectus excavatum, and evidence of a heart murmur. The combination suggests the
possibility of genetic syndrome. You take the relevant family history from the mother.
The mother has two other children, a boy, Bill who is 9 and a girl Emma who is 11, both
are reported to be normal. The mother has two sisters, Kathy and Sarah, both healthy.
Sarah has a son, Tom, who is normal and healthy. Kathy has two daughters, Deborah and
Elizabeth. Mary reports that Elizabeth is in her opinion "not too bright" and "difficult to
control" although her sister Kathy won’t admit there is anything wrong her daughter.
This difference of opinion has caused a rift between the two sisters as Kathy has accused
Mary of shifting blame for the condition of her son on to the rest of the family. Your
suspicion that a genetic syndrome may be affecting your patient and his family are
increasing.
Questions
- What genetic testing is appropriate for this case?
- What are the implications for the rest of the family? Who should also obtain testing?
- What management is suggested for individuals with this disorder?
- What difficulties may be encountered in the counseling of this family?
Resources
Case Study 2
A woman brings her son, Robert, who is an obese four year old, to your clinic for
assessment. She tells you that the staff at the daycare her son attends has expressed
concern over his behaviour and his development. Specifically they are concerned about
her son’s excessive appetite, which has led to problems with the other children at meal
times as he aggressively, sometimes resorting to hitting, tries to take their food. They
also commented on problems he seems to have with speaking and that they do not think
he is keeping up developmentally with the other children his age. The mother
acknowledges that Robert has an insatiable appetite, he is always eating. However she is
unwilling to accept that her child has developmental issues, believing rather that her son’s
obesity is interfering with his ability to play. She wants reassurance that there is nothing
wrong with her child.
You examine Robert. He weighs 22kg and is 95cm in height. He has asked for
something to eat three times since the clinic visit began and is constantly picking at the
skin on his arms and hands. Physically he has small hands and feet. His hands have flat
ulnar borders. He has strabismus and upslanting palpebral fissures, almond shaped eyes
and a narrow bifrontal diameter. His penis is also smaller than normal. He has very fair
skin. His mother tells you that he was very floppy at birth, however his muscle tone did
improve over the first 18 months, and he initially had trouble feeding. The majority of
his weight gain has been in the last 2 years. He is a poor sleeper. He did not walk until
18 months or use words until he was two years of age. From the clinical features of your patient you suspect he may have a genetic syndrome.
Questions
- What is your preliminary diagnosis and what did you base it upon?
- What clinical tests would you suggest are appropriate for this child?
- How would you counsel the parents of this child?
- What management issues would you discuss?
Resources
- Molecular Genetics Report (doc)
- FISH Results (jpg)
- Cytogenetic Report (jpg)
- Methylation Study Results (jpg)
- Chromosome Study Results (jpg)
Case Study 3
You are taking a history from a woman named Betty Smith who has recently been diagnosed with breast cancer at the age of 40. Betty has three children, two daughters and a son. Betty tells you that her mother, Ann Smith, was diagnosed with breast cancer at 38 and ovarian cancer at 50, and died at the age of 52. Betty’s maternal aunt, Deborah Brown, had breast cancer at the age of 48 and a daughter, Melissa (Betty’s cousin), who was diagnosed with ovarian cancer at the age of 33 and died shortly thereafter. There is no other history of cancer in the family. You suspect this history suggests a familial predisposition to cancer may be segregating in this family. To determine if your patient is eligible for genetic testing for familial breast and ovarian cancer use the criteria below that were developed by the Ontario Ministry of Health Predictive Cancer Genetics Program. If the history given by your patient meets or exceeds any category she is eligible for testing.
Questions
- If you are going to undertake the genetic counseling in this case what issues do you need to discuss with your patient?
- What are the implications of the family history and ultimately the test results for the clinical management of your patient and her family?
- In general for all familial cancer syndromes what clinical features are suggestive of the presence of an inherited mutation?
- What has been put forward as the basic genetic mechanism in these conditions?
Resources
- Ontario Ministry of Health Predictive Cancer Genetics Program (pdf)
- Molecular Genetics Report (doc)
- DNA Sequence Results (jpg)
- Protein Truncation Test Results (jpg)
Case Study 4
You were in the neonatal intensive care unit when baby Anne was admitted. Anne was born at
40 weeks to a 29 year-old G5P0S4 (gravida 5, para 0, spontaneous abortions 4) healthy female. Delivery was achieved via C-Section due to breech presentation. Birth weight was 2765 grams, head circumference was 32.0cm, and length was 47cm. The mother, Sue, reported that the pregnancy was unremarkable. She did not have any colds, fever, or flu. She took 20 mg of Prozac 20 once a day and she took prenatal vitamins for the first trimester of pregnancy. She did not drink alcohol or smoke cigarettes. At 19 weeks gestation, an ultrasound was performed for fetal anatomy, which was normal.
The baby was admitted to the NICU because she had thrombocytopenia and elevated direct
bilirubin. An echocardiogram was ordered, which was normal. The senior resident noted that
the baby had some unusual features such as small ears, short neck, and epicanthal folds. Because of the above dysmorphic features, the genetics department was called for a consult. The geneticist performed an examination and confirmed the findings above and noted that the baby also had flat facial profile, broad nasal ridge, protruding tongue, bilateral simian creases, and deep crease between first and second toes. Hypotonia was also noted.
As part of the genetics consult, the family history was taken. Sue said that she was sure that the baby would be healthy as she felt really good throughout this pregnancy. She was especially happy that she did not miscarry after the first trimester, like her other pregnancies. You asked Sue about the miscarriages and she told you that she has had 4, all occurring within the first 10 weeks of pregnancy. She had one miscarriage with her current partner just before she was pregnant with Anne. She had 2 miscarriages with a previous partner and another with her first husband. Sue does not have any sisters or brothers. She reported that her parents also had 3 miscarriages before they had her, so Sue had always assumed that she too, would have several miscarriages before she could have a baby. Sue’s mother, Sophie, is 62 years old and her father, Juan, is 60 years old and both are healthy. Juan has 4 sisters and 2 brothers and they are all healthy. One of Juan’s sisters had a baby who was stillborn and was thought to have multiple congenital anomalies. Sophie has 2 brothers, 3 sisters, and 2 deceased brothers (due to lung cancer, likely related to smoking). Sophie’s other siblings are all healthy.
Questions
The clinical findings are strongly suggestive for a particular syndrome. What genetic testing is
appropriate for this case?
Resources
- Cytogenetics Report (doc)
- Chromosome Study Results (jpg)
November 18th, 2008 at 5:49 pm
This is the only site that will pay you out daily.. So make 50 bucks your first night and you get paid it that night! Check em out its so easy to do you won’t believe you are getting paid to do it.. Oh ya and its completely free.
http://classofcashpabflgg.blogspot.com